Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSin_EF1a_ERT2_CreN59_nMag_P2A_mCh_IRES_PuroR
(Plasmid #192636)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192636 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSIN
  • Vector type
    Mammalian Expression, Lentiviral, Synthetic Biology
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERT2_CreN59_nMag_NLS_P2A_mCh_IRES_PuroR
  • Species
    Synthetic
  • Promoter EF1alpha

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ttcaggtgtcgtgaggaattg
  • 3′ sequencing primer cgccctagatgcatgcggatc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSin_EF1a_ERT2_CreN59_nMag_P2A_mCh_IRES_PuroR was a gift from Yingxiao Wang (Addgene plasmid # 192636 ; http://n2t.net/addgene:192636 ; RRID:Addgene_192636)
  • For your References section:

    An AND-Gated Drug and Photoactivatable Cre-loxP System for Spatiotemporal Control in Cell-Based Therapeutics. Allen ME, Zhou W, Thangaraj J, Kyriakakis P, Wu Y, Huang Z, Ho P, Pan Y, Limsakul P, Xu X, Wang Y. ACS Synth Biol. 2019 Oct 18;8(10):2359-2371. doi: 10.1021/acssynbio.9b00175. Epub 2019 Oct 8. 10.1021/acssynbio.9b00175 PubMed 31592660