pCAG-OSF-ATG13 (2-197)
(Plasmid
#188075)
-
PurposeTo make ATG101/ATG13 HORMA complex for expression in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188075 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 188075-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 188075-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATG13
-
Alt namestrep-strep-Flag-ATG13 (2-197)-stop
-
SpeciesH. sapiens (human)
-
MutationATG13 (2-197)
-
Entrez GeneATG13 (a.k.a. KIAA0652, PARATARG8)
- Promoter CMV
-
Tag
/ Fusion Protein
- strep-strep-Flag tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer CTT CTT CTT TTT CCT ACA GCT CCT GGG C
- 3′ sequencing primer gagccagggcattggccacac
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 188075-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 188075-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-OSF-ATG13 (2-197) was a gift from James Hurley (Addgene plasmid # 188075 ; http://n2t.net/addgene:188075 ; RRID:Addgene_188075) -
For your References section:
Structural basis for ATG9A recruitment to the ULK1 complex in mitophagy initiation. Ren X, Nguyen TN, Lam WK, Buffalo CZ, Lazarou M, Yokom AL, Hurley JH. Sci Adv. 2023 Feb 15;9(7):eadg2997. doi: 10.1126/sciadv.adg2997. Epub 2023 Feb 15. 10.1126/sciadv.adg2997 PubMed 36791199