Skip to main content
Addgene
Open Menu

Mammalian_SaAID2S
(Plasmid #188652)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188652 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 188652-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 188652-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    AID2S-nSaCas9--UGI
  • Species
    Synthetic; Staphylococcus aureus
  • Insert Size (bp)
    5175
  • Mutation
    D10A for SaCas9
  • GenBank ID
  • Promoter EF-1a
  • Tag / Fusion Protein
    • UGI

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer GGGGATCTGTGGTCCTCATA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Sa-sgRNA
  • Species
    Staphylococcus aureus
  • Promoter H1

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATTTGCATGTCGCTATGTGTTCTG
  • 3′ sequencing primer GGCGGAGCCTATGGAAAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Mammalian_SaAID2S was a gift from Keiji Nishida (Addgene plasmid # 188652 ; http://n2t.net/addgene:188652 ; RRID:Addgene_188652)

  • For your References section:

    Cytosine base editing systems with minimized off-target effect and molecular size. Li A, Mitsunobu H, Yoshioka S, Suzuki T, Kondo A, Nishida K. Nat Commun. 2022 Aug 8;13(1):4531. doi: 10.1038/s41467-022-32157-8. 10.1038/s41467-022-32157-8 PubMed 35941130
Related items:
Commonly requested with: