-
Depositing Lab
-
Depositing OrganizationHHMI, Janelia Research Campus
Located in the United States of America -
Publication
-
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 18928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 18928-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 18928-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 5900
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP2-Actin
-
Alt namebeta actin
-
Alt nameACTB
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)2480
-
Entrez GeneACTB (a.k.a. Bact, actin)
-
Tag
/ Fusion Protein
- His (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site Xmal (not destroyed)
- 5′ sequencing primer ggttcggcttctggcgtgtgacc
- 3′ sequencing primer TCC TTA AAC CTG TCT TGT AA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Synthetic construct fused with chicken actin.
DNA (Catalog # 18928-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 18928-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS-GCaMP2-actin was a gift from Karel Svoboda (Addgene plasmid # 18928 ; http://n2t.net/addgene:18928 ; RRID:Addgene_18928) -
For your References section:
Characterization and subcellular targeting of GCaMP-type genetically-encoded calcium indicators. Mao T, O'Connor DH, Scheuss V, Nakai J, Svoboda K. PLoS ONE. 2008 . 3(3):e1796. 10.1371/journal.pone.0001796 PubMed 18350138