Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CMV-GCaMP2
(Plasmid #18927)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 18927 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP2
  • Species
    synthetic construct
  • Insert Size (bp)
    1356
  • GenBank ID
    DQ381402
  • Tag / Fusion Protein
    • His (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NotI/XbaI (not destroyed)
  • 5′ sequencing primer Gccccattgacgcaaatg
  • 3′ sequencing primer caagtaaaacctctacaaatgtgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-GCaMP2 was a gift from Karel Svoboda (Addgene plasmid # 18927 ; http://n2t.net/addgene:18927 ; RRID:Addgene_18927)
  • For your References section:

    Characterization and subcellular targeting of GCaMP-type genetically-encoded calcium indicators. Mao T, O'Connor DH, Scheuss V, Nakai J, Svoboda K. PLoS ONE. 2008 . 3(3):e1796. 10.1371/journal.pone.0001796 PubMed 18350138