Skip to main content

p15A-OptoCre-tetA-Ptet-Rtet
(Plasmid #189855)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 189855 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pBbA-k
  • Backbone size w/o insert (bp) 2432
  • Total vector size (bp) 3563
  • Vector type
    Bacterial Expression, Cre/Lox, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    When transformed with Opto-Cre-Vvd2, store in the dark.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ptet-loxP-TT-loxP-Rtet-tetA
  • Insert Size (bp)
    1609
  • Promoter Ptet

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acttacattaattgcgttgcgc
  • 3′ sequencing primer gccaagcttcgaacatatggtacc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    tetA gene from Ledermann et al Appl Environ Microbiol. 2016 Feb 26. pii: AEM.04085-15.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p15A-OptoCre-tetA-Ptet-Rtet was a gift from Mary Dunlop (Addgene plasmid # 189855 ; http://n2t.net/addgene:189855 ; RRID:Addgene_189855)
  • For your References section:

    An optogenetic toolkit for light-inducible antibiotic resistance. Sheets MB, Tague N, Dunlop MJ. Nat Commun. 2023 Feb 23;14(1):1034. doi: 10.1038/s41467-023-36670-2. 10.1038/s41467-023-36670-2 PubMed 36823420