-
PurposePlasmid encoding SauriABE8e driven by the CMV promoter for plasmid transfection.
-
Depositing Lab
-
Depositing OrganizationBroad Institute
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 189927 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 189927-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 189927-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV with a BR322 origin
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSauriABE8e
-
Insert Size (bp)3897
-
MutationNme2Cas9 D16A
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGTCGTAACAACTCCGCCCCATTGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 189927-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 189927-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-SauriABE8e was a gift from David Liu (Addgene plasmid # 189927 ; http://n2t.net/addgene:189927 ; RRID:Addgene_189927) -
For your References section:
Efficient in vivo base editing via single adeno-associated viruses with size-optimized genomes encoding compact adenine base editors. Davis JR, Wang X, Witte IP, Huang TP, Levy JM, Raguram A, Banskota S, Seidah NG, Musunuru K, Liu DR. Nat Biomed Eng. 2022 Jul 28. pii: 10.1038/s41551-022-00911-4. doi: 10.1038/s41551-022-00911-4. 10.1038/s41551-022-00911-4 PubMed 35902773
