iLID-mCl3-MAP7N
(Plasmid
#190167)
-
PurposeExpresses iLID-mCl3-MAP7N, a microtubule anchor used for optogenetic recruitment of SspB-mCh-p60, in mammalian cells.
-
Depositing Lab
-
Depositing OrganizationUtrecht University
Located in the Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190167 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 190167-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 190167-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepB80
-
Backbone manufacturerLukas Kapitein lab
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 8487
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiLID-mClover3-MAP7N
-
Alt nameiLID-mCl3-MAP7N(1-309)
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2262
-
Mutationaa 1-309 from human MAP7 delta175-213
-
GenBank IDNM_001388339.1
-
Entrez GeneMAP7 (a.k.a. E-MAP-115, EMAP115)
-
Tag
/ Fusion Protein
- iLID-mClover3 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcttctggcgtgtgaccggcgg
- 3′ sequencing primer cctcccacacctccccctgaacct
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 190167-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 190167-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
iLID-mCl3-MAP7N was a gift from Anna Akhmanova (Addgene plasmid # 190167 ; http://n2t.net/addgene:190167 ; RRID:Addgene_190167) -
For your References section:
Opto-katanin, an optogenetic tool for localized, microtubule disassembly. Meiring JCM, Grigoriev I, Nijenhuis W, Kapitein LC, Akhmanova A. Curr Biol. 2022 Nov 7;32(21):4660-4674.e6. doi: 10.1016/j.cub.2022.09.010. Epub 2022 Sep 28. 10.1016/j.cub.2022.09.010 PubMed 36174574
