SspBmicro-mCh-p60
(Plasmid #190168)

• Purpose: Expresses SspBmicro-mCh-p60, a recruitable katanin for microtubule severing, in mammalian cells.
• Depositing Lab: Anna Akhmanova
• Publication: Meiring et al Curr Biol. 2022 Nov 7;32(21):4660-4674.e6. doi: 10.1016/j.cub.2022.09.010. Epub 2022 Sep 28.

Backbone

• Vector backbone: pB80
• Backbone manufacturer: Lukas Kapitein lab
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 8487
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SspBmicro-mCherry-p60
• Alt name: SspB-mCh-p60
• Species: M. musculus (mouse), Synthetic
• Insert Size (bp): 2751
• GenBank ID: NM_011835.3
• Tag / Fusion Protein:
  • SspBmicro-mCherry (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggcttctggcgtgtgaccggcgg
• 3′ sequencing primer: cctcccacacctccccctgaacct

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry