Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

iLID-mCl3-MAP7N
(Plasmid #190167)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 190167 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pB80
  • Backbone manufacturer
    Lukas Kapitein lab
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 8487
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    iLID-mClover3-MAP7N
  • Alt name
    iLID-mCl3-MAP7N(1-309)
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2262
  • Mutation
    aa 1-309 from human MAP7 delta175-213
  • GenBank ID
    NM_001388339.1
  • Tag / Fusion Protein
    • iLID-mClover3 (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggcttctggcgtgtgaccggcgg
  • 3′ sequencing primer cctcccacacctccccctgaacct
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    iLID-mCl3-MAP7N was a gift from Anna Akhmanova (Addgene plasmid # 190167 ; http://n2t.net/addgene:190167 ; RRID:Addgene_190167)
  • For your References section:

    Opto-katanin, an optogenetic tool for localized, microtubule disassembly. Meiring JCM, Grigoriev I, Nijenhuis W, Kapitein LC, Akhmanova A. Curr Biol. 2022 Nov 7;32(21):4660-4674.e6. doi: 10.1016/j.cub.2022.09.010. Epub 2022 Sep 28. 10.1016/j.cub.2022.09.010 PubMed 36174574