pCASB
(Plasmid
#190175)
-
PurposePlasmid for yeast expression of Cas9; contains a golden gate cloning site to additionally express a gRNA for a target sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190175 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAS
-
Backbone manufacturerAddgene #60847
- Total vector size (bp) 8743
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersKanMX (select with G418 in yeast)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA cloning site
-
SpeciesSynthetic
-
Insert Size (bp)22
-
MutationAdded 5'-agagacc-3' upstream and 5'-ggtctca-3' downstream of the gRNA site to allow for golden gate cloning of new gRNAs with the restriction enzyme Bsa1
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer gRNA_seq CGGAATAGGAACTTCAAAGCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is a modified version of pCAS (Addgene #60847) that has been improved to facilitate rapid cloning of new gRNA sequencing for streamlined CRISPR-Cas9 genome editing in yeast. pCAS was originally published by:
Ryan et al Elife. 2014 Aug 19;3. doi: 10.7554/eLife.03703.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCASB was a gift from Jessica Tyler (Addgene plasmid # 190175 ; http://n2t.net/addgene:190175 ; RRID:Addgene_190175) -
For your References section:
A Simple, Improved Method for Scarless Genome Editing of Budding Yeast Using CRISPR-Cas9. Aguilar RR, Shen ZJ, Tyler JK. Methods Protoc. 2022 Oct 4;5(5):79. doi: 10.3390/mps5050079. 10.3390/mps5050079 PubMed 36287051