-
PurposeThis strain is used for expressing phosphoserine-containing proteins using genetic code expansion without buildup of prematurely truncated protein.
-
Depositing Labs
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Bacterial Strain | 197655 | Bacteria in agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonen/a
-
Vector typeThis is a strain, not a plasmid
Growth in Bacteria
-
Bacterial Resistance(s)None
-
Growth Temperature37°C
-
Growth Strain(s)B95(DE3) ΔA ΔfabR ΔserB
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameThis strain is a derivative of BL21(DE3) with no specific assignment of the UAG codo
-
Speciesn/a
Cloning Information
- Cloning method Unknown
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Derivative of BL21(DE3) with no specific assignment of the UAG codon
- 95 endogenous TAG codons mutated to TAA
- RF1 (prfA) deleted and fabR spontaneously mutated
- serB deleted for phosphoserine genetic code expansion expression applications
Primers for verification:
- for RF1 (prfA) deletion: AAGCCTTCTATCGTTGCCAAAC, TTATTCCTGCTCGGACAACG
- for serB deletion: AGTTTTGTGCGAGCCATCTTCCACC, GTGATGGTGTTCCAGGCATGACAGG
This strain is used for expressing phosphoserine-containig proteins using genetic code expansion without buildup of prematurely truncated protein
- Recommended plasmids for expressing phosphorylated proteins in this strain are Addgene #173897 (pSer GCE machinery vector) and #174075/174076 (compatible p15a origin of replication plasmids expressing sfGFP proteins from a T7 promoter; sfGFP genes can be removed by restriction digest and replaced with protein-of-interest).
Original B95 strain: Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
B95(DE3) ΔA ΔfabR ΔserB was a gift from Richard Cooley & Ryan Mehl (Addgene plasmid # 197655) -
For your References section:
A Highly Versatile Expression System for the Production of Multiply Phosphorylated Proteins. Zhu P, Gafken PR, Mehl RA, Cooley RB. ACS Chem Biol. 2019 Jul 19;14(7):1564-1572. doi: 10.1021/acschembio.9b00307. Epub 2019 Jun 17. 10.1021/acschembio.9b00307 PubMed 31243963