pJB07
(Plasmid #190481)

• Purpose: Targeting plasmid for 2-plasmid C. difficile mutagenesis system
• Depositing Lab: Joseph Sorg
• Publication: Brehm et al Microbiol Resour Announc. 2022 Dec 15;11(12):e0083322. doi: 10.1128/mra.00833-22. Epub 2022 Nov 7.

Backbone

• Vector backbone: pJB11
• Total vector size (bp): 8357
• Modifications to backbone: Addition of region of homology for pyrE deletion, gRNA, xylR-driven promotion region
• Vector type: E. coli / B. subtilis - C. difficile shuttle vector

Growth in Bacteria

• Bacterial Resistance(s): Erythromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Upstream & Downstream pyrE deletion region
• Species: C. difficile
• Insert Size (bp): 2000

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ttatcaggaaacagctatgaccgcggccgc
• 3′ sequencing primer: agugccaaguugcaugucugcaggcucgag

Gene/Insert 2

• Gene/Insert name: gRNA
• Insert Size (bp): 140

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: TTATGAAGTGGCATTCAAGGAGGGggtacc
• 3′ sequencing primer: caggcuucuuauuuuuaugcuagcACGCGU

Resource Information

• Supplemental Documents:
  • pjb07(1).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry