pJB07
(Plasmid
#190481)
-
PurposeTargeting plasmid for 2-plasmid C. difficile mutagenesis system
-
Depositing Lab
-
Depositing OrganizationTexas A&M University
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190481 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 190481-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 190481-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepJB11
- Total vector size (bp) 8357
-
Modifications to backboneAddition of region of homology for pyrE deletion, gRNA, xylR-driven promotion region
-
Vector typeE. coli / B. subtilis - C. difficile shuttle vector
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameUpstream & Downstream pyrE deletion region
-
SpeciesC. difficile
-
Insert Size (bp)2000
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ttatcaggaaacagctatgaccgcggccgc
- 3′ sequencing primer agugccaaguugcaugucugcaggcucgag
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegRNA
-
Insert Size (bp)140
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer TTATGAAGTGGCATTCAAGGAGGGggtacc
- 3′ sequencing primer caggcuucuuauuuuuaugcuagcACGCGU
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 190481-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 190481-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB07 was a gift from Joseph Sorg (Addgene plasmid # 190481 ; http://n2t.net/addgene:190481 ; RRID:Addgene_190481) -
For your References section:
Plasmid Sequence and Availability for an Improved Clostridioides difficile CRISPR-Cas9 Mutagenesis System. Brehm JN, Sorg JA. Microbiol Resour Announc. 2022 Dec 15;11(12):e0083322. doi: 10.1128/mra.00833-22. Epub 2022 Nov 7. 10.1128/mra.00833-22 PubMed 36342279