Skip to main content

pJB06
(Plasmid #190480)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190480 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 190480-D50 50 μg of DNA in Tris buffer $495
DNA 190480-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pHN149
  • Backbone size w/o insert (bp) 7084
  • Total vector size (bp) 12489
  • Vector type
    E. coli / B. subtilis - C. difficile shuttle vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4107
  • Promoter xylR-driven promoter

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAAGGAGGGTAAAGAGGAGAGttaattaa
  • 3′ sequencing primer tgccaagcttgcatgtctgcaggcctcgag
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    XylR
  • Insert Size (bp)
    1227

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer caatttttttatcaggaaacagctatgacc
  • 3′ sequencing primer TAATAATAAAATATTTAATTATCTTTGTCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJB06 was a gift from Joseph Sorg (Addgene plasmid # 190480 ; http://n2t.net/addgene:190480 ; RRID:Addgene_190480)
  • For your References section:

    Plasmid Sequence and Availability for an Improved Clostridioides difficile CRISPR-Cas9 Mutagenesis System. Brehm JN, Sorg JA. Microbiol Resour Announc. 2022 Dec 15;11(12):e0083322. doi: 10.1128/mra.00833-22. Epub 2022 Nov 7. 10.1128/mra.00833-22 PubMed 36342279