Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCas
(Plasmid #62225)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62225 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pKD46
  • Backbone size w/o insert (bp) 6300
  • Modifications to backbone
    Replace Amp with Kan
  • Vector type
    Bacterial Expression, CRISPR ; Lambda Red recombinase

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Must be grown at 30C! Vector has temperature-sensitive replication (RepA101ts)
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    cas9
  • Species
    S. pyogenes MGAS5005
  • Insert Size (bp)
    4500
  • Promoter native cas9 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer pENTR1A-3 (GTAACATCAGAGATTTTGAGACAC)
  • 3′ sequencing primer AraC-F-New (GATGTAGCCGTCAAGTTGTCA)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCas was a gift from Sheng Yang (Addgene plasmid # 62225 ; http://n2t.net/addgene:62225 ; RRID:Addgene_62225)
  • For your References section:

    Multigene editing in the Escherichia coli genome using the CRISPR-Cas9 system. Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S. Appl Environ Microbiol. 2015 Jan 30. pii: AEM.04023-14. 10.1128/AEM.04023-14 PubMed 25636838