pCas
(Plasmid #62225)

• Purpose: Constitutive expression of cas9 and inducible expression of lambda RED and sgR
• Depositing Lab: Sheng Yang
• Publication: Jiang et al Appl Environ Microbiol. 2015 Jan 30. pii: AEM.04023-14.
• Citations: 67 Articles

Backbone

• Vector backbone: pKD46
• Backbone size w/o insert (bp): 6300
• Modifications to backbone: Replace Amp with Kan
• Vector type: Bacterial Expression, CRISPR ; Lambda Red recombinase

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Growth instructions: Must be grown at 30C! Vector has temperature-sensitive replication (RepA101ts)
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: cas9
• Species: S. pyogenes MGAS5005
• Insert Size (bp): 4500
• Promoter: native cas9 promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: pENTR1A-3 (GTAACATCAGAGATTTTGAGACAC)
• 3′ sequencing primer: AraC-F-New (GATGTAGCCGTCAAGTTGTCA)

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry