-
PurposeConstitutive expression of cas9 and inducible expression of lambda RED and sgR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | |
Cloning Grade DNA | 62225-DNA.cg | 2 µg of cloning grade DNA in Tris buffer | 1 | $95 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepKD46
- Backbone size w/o insert (bp) 6300
-
Modifications to backboneReplace Amp with Kan
-
Vector typeBacterial Expression, CRISPR ; Lambda Red recombinase
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMust be grown at 30C! Vector has temperature-sensitive replication (RepA101ts)
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namecas9
-
SpeciesS. pyogenes MGAS5005
-
Insert Size (bp)4500
- Promoter native cas9 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer pENTR1A-3 (GTAACATCAGAGATTTTGAGACAC)
- 3′ sequencing primer AraC-F-New (GATGTAGCCGTCAAGTTGTCA) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Information for Cloning Grade DNA (Catalog # 62225-DNA.cg) ( Back to top )
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $95 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas was a gift from Sheng Yang (Addgene plasmid # 62225 ; http://n2t.net/addgene:62225 ; RRID:Addgene_62225) -
For your References section:
Multigene editing in the Escherichia coli genome using the CRISPR-Cas9 system. Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S. Appl Environ Microbiol. 2015 Jan 30. pii: AEM.04023-14. 10.1128/AEM.04023-14 PubMed 25636838