Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pTargetF
(Plasmid #62226)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62226 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Trc99a
  • Backbone size w/o insert (bp) 2000
  • Modifications to backbone
    Replaced Amp with aadA
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA
  • gRNA/shRNA sequence
    GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTG
  • Species
    Synthetic
  • Promoter pij23119

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer MoClo-F (agcgaggaagcggaagagcg)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTargetF was a gift from Sheng Yang (Addgene plasmid # 62226 ; http://n2t.net/addgene:62226 ; RRID:Addgene_62226)
  • For your References section:

    Multigene editing in the Escherichia coli genome using the CRISPR-Cas9 system. Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S. Appl Environ Microbiol. 2015 Jan 30. pii: AEM.04023-14. 10.1128/AEM.04023-14 PubMed 25636838