pAf-CRISPR-yA
(Plasmid
#191015)
-
PurposeCRISPR vector based on Aspergillus flavus U6 promoter and terminator for targeting the yA gene, which contains AMA1(the HindIII-PstI fragment) and ptrA selection marker.
-
Depositing Lab
-
Depositing OrganizationUSDA ARS New Orleans, Southern Regional Research Center
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191015 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 191015-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 191015-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepPTRII
-
Backbone manufacturerTaKaRa
- Backbone size w/o insert (bp) 10031
- Total vector size (bp) 13436
-
Modifications to backboneRemoval of the PstI fragment of pPTRII (AMA1), expression of cas9 using Aspergillus nidulans gpdA promoter and trpC terminator, expression of sgRNA using Aspergillus flavus U6 promoter and terminator.
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameyA
-
gRNA/shRNA sequenceTTAGTGAGAATCATTTGGCG
-
SpeciesAspergillus flavus
- Promoter Aspergillus flavus U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer ATACTGCAGTTCTCTTTAGAATTCAACTGTGGGT
- 3′ sequencing primer TATGGTACCACATATTTAAAAAAAGTCTCCTGCC
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 191015-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 191015-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAf-CRISPR-yA was a gift from Perng-Kuang Chang (Addgene plasmid # 191015 ; http://n2t.net/addgene:191015 ; RRID:Addgene_191015) -
For your References section:
A Simple CRISPR/Cas9 System for Efficiently Targeting Genes of Aspergillus Section Flavi Species, Aspergillus nidulans, Aspergillus fumigatus, Aspergillus terreus, and Aspergillus niger. Chang PK. Microbiol Spectr. 2023 Feb 14;11(1):e0464822. doi: 10.1128/spectrum.04648-22. Epub 2023 Jan 18. 10.1128/spectrum.04648-22 PubMed 36651760