pVioCD53
(Plasmid #191130)

• Purpose: Expression of vioC, truncated vioD and tdMCP form a J23105 constitutive promoter
• Depositing Lab: Ariel Lindner
• Publication: Guo et al Cell. 2022 Sep 29;185(20):3823-3837.e23. doi: 10.1016/j.cell.2022.09.016.

Backbone

• Vector backbone: pSB1A3-J23105
• Backbone size w/o insert (bp): 2301
• Total vector size (bp): 4886
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: use BL21A1 for protein expression
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: vioC
• Species: Synthetic
• Insert Size (bp): 1284
• Entrez Gene: vioC (a.k.a. CV_3272)
• Promoter: J23105 constitutive promoter

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: tgccacctgacgtctaagaa

Gene/Insert 2

• Gene/Insert name: vioD truncated
• Alt name: vioD
• Species: Synthetic
• Insert Size (bp): 790
• Mutation: C-terminal truncation from 264th amino acid

Gene/Insert 3

• Gene/Insert name: dMCP off-frame
• Alt name: MCP
• Alt name: dMCP
• Species: Synthetic
• Insert Size (bp): 291

Resource Information

• Supplemental Documents:
  • pviocd53.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry