pSN-A112C-1A32
(Plasmid
#191241)
-
PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-1A32 and a His-tag, for fluorescent studies.
-
Depositing Lab
-
Depositing OrganizationUniversity of Wisconsin, Madison
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191241 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET-28
- Backbone size w/o insert (bp) 5206
- Total vector size (bp) 5860
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namenuc (nuclease A), HLA-A (HLAA) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
-
SpeciesH. sapiens (human); Staphylococcus aureus
-
Insert Size (bp)654
-
MutationChanged Alanine 112 to Cysteine in SN, and predicted interfacial residues of the transmembrane domain are in a poly-leu background
-
GenBank IDP10314 (P04439) P00644
-
Entrez GeneHLA-A (a.k.a. HLAA)
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- nuclease A from S. aureus fused to the poly-Leu TM domain of HLA-A. The construct has a c-terminal His-tag for purification.
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer taatacgactcactataggg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.07.11.499632 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSN-A112C-1A32 was a gift from Alessandro Senes (Addgene plasmid # 191241 ; http://n2t.net/addgene:191241 ; RRID:Addgene_191241) -
For your References section:
Thermodynamic analysis of the GAS(right) transmembrane motif supports energetic model of dimerization. Diaz Vazquez G, Cui Q, Senes A. Biophys J. 2023 Jan 3;122(1):143-155. doi: 10.1016/j.bpj.2022.11.018. Epub 2022 Nov 12. 10.1016/j.bpj.2022.11.018 PubMed 36371634