Skip to main content
Addgene
Open Menu

CCR5_gRNA_pX459
(Plasmid #192268)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192268 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 192268-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 192268-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0
  • Backbone manufacturer
    Feng Zhang
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CCR5 guide RNA
  • gRNA/shRNA sequence
    GGAGAGCTTGGCTCTGTTGG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 3′ sequencing primer cgtaagttatgtaacgggtacc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CCR5_gRNA_pX459 was a gift from Shantanu Chowdhury (Addgene plasmid # 192268 ; http://n2t.net/addgene:192268 ; RRID:Addgene_192268)

  • For your References section:

    Human telomerase is directly regulated by non-telomeric TRF2-G-quadruplex interaction. Sharma S, Mukherjee AK, Roy SS, Bagri S, Lier S, Verma M, Sengupta A, Kumar M, Nesse G, Pandey DP, Chowdhury S. Cell Rep. 2021 May 18;35(7):109154. doi: 10.1016/j.celrep.2021.109154. 10.1016/j.celrep.2021.109154 PubMed 34010660
Related items:
Commonly requested with: