pCas-pML-1B_6xHis-Cas12m
(Plasmid
#192282)
-
PurposeMmCas12m fused to His-tag for protein purification
-
Depositing Lab
-
Depositing OrganizationWageningen University, Department Agrotechnology & Food Sciences
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192282 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET His6 TEV LIC cloning vector (1B)
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMmCas12m
-
SpeciesSynthetic; Mycolicibacterium mucogenicum CCH10-A2
-
Insert Size (bp)1791
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ggtgatgtcggcgatatagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas-pML-1B_6xHis-Cas12m was a gift from John van der Oost (Addgene plasmid # 192282 ; http://n2t.net/addgene:192282 ; RRID:Addgene_192282) -
For your References section:
The miniature CRISPR-Cas12m effector binds DNA to block transcription. Wu WY, Mohanraju P, Liao C, Adiego-Perez B, Creutzburg SCA, Makarova KS, Keessen K, Lindeboom TA, Khan TS, Prinsen S, Joosten R, Yan WX, Migur A, Laffeber C, Scott DA, Lebbink JHG, Koonin EV, Beisel CL, van der Oost J. Mol Cell. 2022 Dec 1;82(23):4487-4502.e7. doi: 10.1016/j.molcel.2022.11.003. Epub 2022 Nov 24. 10.1016/j.molcel.2022.11.003 PubMed 36427491