pOPINF Ta-sro1 PARP
(Plasmid #192549)

• Purpose: E. coli expression vector for Triticum aestivum sro1 PARP domain (amino acids 246-434)
• Depositing Lab: Lennart Wirthmueller
• Publication: Vogt et al Plant Cell. 2022 Aug 18. pii: 6671231. doi: 10.1093/plcell/koac261.

Backbone

• Vector backbone: pOPINF
• Backbone manufacturer: Berrow et al. (2007) PMID 17317681
• Backbone size w/o insert (bp): 5142
• Total vector size (bp): 5769
• Vector type: Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SIMILAR TO RCD ONE 1 (SRO1) PARP domain, cultivar Shanrong No. 3 (SR3)
• Alt name: Ta-sro1
• Alt name: PARP fragment
• Alt name: poly(ADP-ribose) polymerase
• Species: Triticum aestivum
• Insert Size (bp): 627
• GenBank ID: AEK94072
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • His6, 3C protease cleavage site (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: CACCACCTTCTGATAGGCAG

Resource Information

• Supplemental Documents:
  • pOPIN-F Ta-sro1 PARP (246-434).gb
• A portion of this plasmid was derived from a plasmid made by: gene synthesis based on sequence information from Liu et al. 2004, PMID 24443520

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry