pCK668
(Plasmid
#192637)
-
PurposeExpresses dCas9-NG and MCP-SoxS(R93A/S101A) on p15A-CmR
-
Depositing Lab
-
Depositing OrganizationUniversity of Washington
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192637 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 192637-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 192637-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCD442 (Addgene #153024)
-
Backbone manufacturerJesse Zalatan
- Backbone size w/o insert (bp) 1726
- Total vector size (bp) 7368
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameSp.pCas9-dCas9-NG
-
SpeciesS. pyogenes (dCas9)
-
Insert Size (bp)4650
-
MutationdCas9-NG has several mutations compared to dCas9
- Promoter Sp.pCas9
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAACTGACTGAAATGCCTC
- 3′ sequencing primer GCCTGGagatccttactcga
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBBa_J23107-MCP-SoxS(R93A, S101A)
-
SpeciesMS2 (MCP), E. coli (SoxS)
-
Insert Size (bp)802
-
MutationSoxS has R93A and S101A mutations
- Promoter BBa_J23107
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer tcagggtggtgaatctgcag
- 3′ sequencing primer tcgtaagccatttccgctcg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byadapted from Neville Sanjana lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 192637-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 192637-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCK668 was a gift from Jesse Zalatan (Addgene plasmid # 192637 ; http://n2t.net/addgene:192637 ; RRID:Addgene_192637) -
For your References section:
Expanding the Scope of Bacterial CRISPR Activation with PAM-Flexible dCas9 Variants. Kiattisewee C, Karanjia AV, Legut M, Daniloski Z, Koplik SE, Nelson J, Kleinstiver BP, Sanjana NE, Carothers JM, Zalatan JG. ACS Synth Biol. 2022 Nov 15. doi: 10.1021/acssynbio.2c00405. 10.1021/acssynbio.2c00405 PubMed 36378874