Skip to main content

pCK340
(Plasmid #192639)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192639 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 192639-D50 50 μg of DNA in Tris buffer $495
DNA 192639-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCD442 (Addgene #153024)
  • Backbone manufacturer
    Jesse Zalatan
  • Backbone size w/o insert (bp) 1726
  • Total vector size (bp) 7368
  • Vector type
    CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Sp.pCas9-dSpG
  • Species
    S. pyogenes (dCas9)
  • Insert Size (bp)
    4650
  • Mutation
    dSpG has several mutations compared to dCas9
  • Promoter Sp.pCas9

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAACTGACTGAAATGCCTC
  • 3′ sequencing primer GCCTGGagatccttactcga
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    BBa_J23107-MCP-SoxS(R93A, S101A)
  • Species
    MS2 (MCP), E. coli (SoxS)
  • Insert Size (bp)
    802
  • Mutation
    SoxS has R93A and S101A mutations
  • Promoter BBa_J23107

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcagggtggtgaatctgcag
  • 3′ sequencing primer tcgtaagccatttccgctcg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    adapted from Benjamin Kleinstiver lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCK340 was a gift from Jesse Zalatan (Addgene plasmid # 192639 ; http://n2t.net/addgene:192639 ; RRID:Addgene_192639)
  • For your References section:

    Expanding the Scope of Bacterial CRISPR Activation with PAM-Flexible dCas9 Variants. Kiattisewee C, Karanjia AV, Legut M, Daniloski Z, Koplik SE, Nelson J, Kleinstiver BP, Sanjana NE, Carothers JM, Zalatan JG. ACS Synth Biol. 2022 Nov 15. doi: 10.1021/acssynbio.2c00405. 10.1021/acssynbio.2c00405 PubMed 36378874