pSems-leader-mXFPe-IFNGR2(30-337)
(Plasmid
#192787)
-
PurposeExpression of mXFPe-tagged IFNGR2 at the plasma membrane, e.g. for single molecule fluorescence microscopy
-
Depositing Lab
-
Depositing OrganizationUniversitaet Osnabrueck
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192787 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 192787-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 192787-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSEMS(26m)
-
Backbone manufacturerCovalys, NEB
- Backbone size w/o insert (bp) 5787
- Total vector size (bp) 6950
-
Modifications to backboneoriginal SNAP-tag substituted
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFNGR2
-
Alt nameInterferon gamma receptor subunit 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1752
-
MutationmXFPe: tyrosine 66 to phenylalanine, asparagine 198 to aspartic acid and tyrosine 200 to phenylalanine
-
GenBank IDNM_005534.4
-
Entrez GeneIFNGR2 (a.k.a. AF-1, IFGR2, IFNGT1, IMD28)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Ig k-chain leader sequence (N terminal on insert)
- mXFPe (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAACAGCTGGCCCTCGCAGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 192787-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 192787-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSems-leader-mXFPe-IFNGR2(30-337) was a gift from Jacob Piehler (Addgene plasmid # 192787 ; http://n2t.net/addgene:192787 ; RRID:Addgene_192787) -
For your References section:
Four-color single-molecule imaging with engineered tags resolves the molecular architecture of signaling complexes in the plasma membrane. Sotolongo Bellon J, Birkholz O, Richter CP, Eull F, Kenneweg H, Wilmes S, Rothbauer U, You C, Walter MR, Kurre R, Piehler J. Cell Rep Methods. 2022 Feb 4;2(2):100165. doi: 10.1016/j.crmeth.2022.100165. eCollection 2022 Feb 28. 10.1016/j.crmeth.2022.100165 PubMed 35474965