Skip to main content

pSems-leader-mXFPe-IFNGR2(30-337)
(Plasmid #192787)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192787 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 192787-D50 50 μg of DNA in Tris buffer $495
DNA 192787-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSEMS(26m)
  • Backbone manufacturer
    Covalys, NEB
  • Backbone size w/o insert (bp) 5787
  • Total vector size (bp) 6950
  • Modifications to backbone
    original SNAP-tag substituted
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IFNGR2
  • Alt name
    Interferon gamma receptor subunit 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1752
  • Mutation
    mXFPe: tyrosine 66 to phenylalanine, asparagine 198 to aspartic acid and tyrosine 200 to phenylalanine
  • GenBank ID
    NM_005534.4
  • Entrez Gene
    IFNGR2 (a.k.a. AF-1, IFGR2, IFNGT1, IMD28)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Ig k-chain leader sequence (N terminal on insert)
    • mXFPe (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAACAGCTGGCCCTCGCAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSems-leader-mXFPe-IFNGR2(30-337) was a gift from Jacob Piehler (Addgene plasmid # 192787 ; http://n2t.net/addgene:192787 ; RRID:Addgene_192787)
  • For your References section:

    Four-color single-molecule imaging with engineered tags resolves the molecular architecture of signaling complexes in the plasma membrane. Sotolongo Bellon J, Birkholz O, Richter CP, Eull F, Kenneweg H, Wilmes S, Rothbauer U, You C, Walter MR, Kurre R, Piehler J. Cell Rep Methods. 2022 Feb 4;2(2):100165. doi: 10.1016/j.crmeth.2022.100165. eCollection 2022 Feb 28. 10.1016/j.crmeth.2022.100165 PubMed 35474965