pSems-leader-mXFPm-IFNGR1(18-489)
(Plasmid #192786)

• Purpose: Expression of mXFPm-tagged IFNGR1 at the plasma membrane, e.g. for single molecule fluorescence microscopy
• Depositing Lab: Jacob Piehler
• Depositing Organization: Universitaet Osnabrueck
  Located in Germany
• Publication: Sotolongo Bellon et al Cell Rep Methods. 2022 Feb 4;2(2):100165. doi: 10.1016/j.crmeth.2022.100165. eCollection 2022 Feb 28.

Backbone

• Vector backbone: pSEMS(26m)
• Backbone manufacturer: Covalys, NEB
• Backbone size w/o insert (bp): 5787
• Total vector size (bp): 7438
• Modifications to backbone: original SNAP-tag substituted
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: IFNGR1
• Alt name: Interferon gamma receptor subunit 1
• Species: H. sapiens (human)
• Insert Size (bp): 2235
• Mutation: mXFPm: tryptophan 66 to phenylalanine, gluatmic acid 142 to asparagine and histidine 164 to asparagine
• GenBank ID: NM_000416.3
• Entrez Gene: IFNGR1 (a.k.a. CD119, IFNGR, IMD27A, IMD27B)
• Promoter: CMV
• Tags / Fusion Proteins:
  • Ig k-chain leader sequence (N terminal on insert)
  • mXFPm (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CAACAGCTGGCCCTCGCAGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 192786-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 192786-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.