Skip to main content
Addgene
Open Menu

pAd-PR.Cre
(Plasmid #192936)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 192936 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
Add to Cart
DNA 192936-D50 50 μg of DNA in Tris buffer $495 *
Add to Cart
DNA 192936-D100 100 μg of DNA in Tris buffer $585 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pAd/PL-Dest
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 34864
  • Total vector size (bp) 35583
  • Vector type
    Mammalian Expression, Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Trp53
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2349
  • Entrez Gene
    Trp53 (a.k.a. Tp53, bbl, bfy, bhy, p44, p53)
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GACTTTGACCGTTTACGTGGAGA
  • 3′ sequencing primer CAATGCTGGAGCCCATCACAT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Rb1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2349
  • Entrez Gene
    Rb1 (a.k.a. Rb, Rb-1, p110-RB1, pRb, pp105)
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GACTTTGACCGTTTACGTGGAGA
  • 3′ sequencing primer CAATGCTGGAGCCCATCACAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAd-PR.Cre was a gift from Thorsten Stiewe (Addgene plasmid # 192936 ; http://n2t.net/addgene:192936 ; RRID:Addgene_192936)

  • For your References section:

    Monitoring autochthonous lung tumors induced by somatic CRISPR gene editing in mice using a secreted luciferase. Merle N, Elmshauser S, Strassheimer F, Wanzel M, Konig AM, Funk J, Neumann M, Kochhan K, Helmprobst F, Pagenstecher A, Nist A, Mernberger M, Schneider A, Braun T, Borggrefe T, Savai R, Timofeev O, Stiewe T. Mol Cancer. 2022 Oct 3;21(1):191. doi: 10.1186/s12943-022-01661-2. 10.1186/s12943-022-01661-2 PubMed 36192757
Related items: