-
Purposeepisomal mCherry-hS*K (expressing mCherry + human super-SOX + KLF4) for integration-free naïve conversion
-
Depositing Lab
-
Depositing OrganizationMax Planck Institute for Molecular Biomedicine
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193294 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 193294-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 193294-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCXLE
- Backbone size w/o insert (bp) 10180
- Total vector size (bp) 13653
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry-t2a-SOX2-17-p2a-KLF4
-
Alt namesuperSOX
-
Alt nameS*
-
Alt nameKLF4
-
SpeciesH. sapiens (human); Discosoma
-
Insert Size (bp)3473
-
MutationSOX2-17 is engineered highly cooperative chimeric transcription factor, where the following elements of SOX2 were swapped with SOX17: 43-47, 61, 65-86 and CTD
-
Entrez GeneSOX2 (a.k.a. ANOP3, MCOPS3)
-
Entrez GeneKLF4 (a.k.a. EZF, GKLF)
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer tctgctaaccatgttcatgccttc
- 3′ sequencing primer AGGAAGGTCCGCTGGATTGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.09.23.509242v1 for BioRxiv preprint
DNA (Catalog # 193294-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 193294-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCXLE-mCherry-t2a-SOX2-17-p2a-KLF4 was a gift from Hans Schöler (Addgene plasmid # 193294 ; http://n2t.net/addgene:193294 ; RRID:Addgene_193294) -
For your References section:
Highly cooperative chimeric super-SOX induces naive pluripotency across species. MacCarthy CM, Wu G, Malik V, Menuchin-Lasowski Y, Velychko T, Keshet G, Fan R, Bedzhov I, Church GM, Jauch R, Cojocaru V, Scholer HR, Velychko S. Cell Stem Cell. 2024 Jan 4;31(1):127-147.e9. doi: 10.1016/j.stem.2023.11.010. Epub 2023 Dec 22. 10.1016/j.stem.2023.11.010 PubMed 38141611