NcCas9
(Plasmid #194093)

• Purpose: Expresses human codon optimized NcCas9. Genome editing in human cells.
• Depositing Lab: Zhanjun Li
• Publication: Liu et al Commun Biol. 2022 Nov 26;5(1):1296. doi: 10.1038/s42003-022-04258-z.

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 3300
• Total vector size (bp): 6765
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: NcCas9
• Species: Synthetic
• Insert Size (bp): 3300
• Promoter: CMV

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: taatacgactcactatagg
• 3′ sequencing primer: tagaaggcacagtcgaggctgat

Resource Information

• Supplemental Documents:
  • NcCas9
• A portion of this plasmid was derived from a plasmid made by: NcCas9 synthesized by Genscript Biotech.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry