pOxyR_gfp
(Plasmid #194154)

• Purpose: Green Fluorescent Reporter of intracellular hydrogen peroxide
• Depositing Lab: Sven Panke
• Publication: Kardashliev et al Chem Sci. 2021 Oct 29;12(44):14766-14772. doi: 10.1039/d1sc02578c. eCollection 2021 Nov 17.

Backbone

• Vector backbone: pSEVA-based
• Backbone manufacturer: https://seva-plasmids.com/
• Backbone size w/o insert (bp): 2390
• Total vector size (bp): 4158
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Streptomycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Growth instructions: Depositing Lab uses E. coli BL21 (DE3) Gold lacIq1 at 30 C for protein production.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein sfGFP
• Species: E. coli
• Insert Size (bp): 1768
• Promoter: PoxyR, PoxyS

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCGAGCGTTCTGAACAAATC
• 3′ sequencing primer: CCCAGTCTTTCGACTGAG

Resource Information

• Supplemental Documents:
  • pOxyR-gfp.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry