FUW-crRNA1and2-U6_TRE-dLbCpf1-NLS-hCTCF_R396A-HA-P2A-tagBFP
(Plasmid #194888)

• Purpose: Dox-inducible all-in-one lentiviral construct to express dCpf1-CTCF-R396A mutant and crRNA-1 and -2 targeting the human MECP2 locus.
• Depositing Lab: Shawn Liu
• Publication: Qian et al Sci Transl Med. 2023 Jan 18;15(679):eadd4666. doi: 10.1126/scitranslmed.add4666. Epub 2023 Jan 18.

Backbone

• Vector backbone: Fuw
• Backbone size w/o insert (bp): 5946
• Total vector size (bp): 15631
• Modifications to backbone: Fuw-TRE-HA-P2A-tagBFP
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: tagBFP by FACS

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: dLbCpf1-NLS-hCTCF_R396A
• Species: Synthetic
• Insert Size (bp): 5946
• Mutation: Human codon optimized catalytically inactive LbCpf1 (dLbCpf1) with mutation of D832A; CTCF with mutations of R396A
• Promoter: TRE
• Tag / Fusion Protein:
  • HA (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgtatgcagactttactccc
• 3′ sequencing primer: taaagcagcgtatcc

Gene/Insert 2

• Gene/Insert name: U6-crRNA1and2
• Species: Synthetic
• Insert Size (bp): 359
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgggtttattacagggacag

Resource Information

• Supplemental Documents:
  • FUW-MECP2 looping_Lb-DR_U6-TRE3G-dLbCpf1-NLS-27-hCTCF_R396A-HA-P2A-tagBFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Zeo marker is outside the LTRs and will not be packaged into virus.