Skip to main content

Halo-TMD
(Plasmid #195347)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195347 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 195347-D50 50 μg of DNA in Tris buffer $495
DNA 195347-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    TfR-sfGFP-myc tag-SpyCatcher003 Sequences
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 5810
  • Total vector size (bp) 6698
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HaloTag
  • Species
    Synthetic
  • Insert Size (bp)
    888
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATCGGCACGGGCTTTCCGTTTG
  • 3′ sequencing primer TTCCAGCCCGGAGATCTCCAGTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Halo-TMD was a gift from Allen Liu (Addgene plasmid # 195347 ; http://n2t.net/addgene:195347 ; RRID:Addgene_195347)
  • For your References section:

    Mechanosensitive Channel-Based Optical Membrane Tension Reporter. Hsu YY, Resto Irizarry AM, Fu J, Liu AP. ACS Sens. 2023 Jan 27;8(1):12-18. doi: 10.1021/acssensors.2c01921. Epub 2023 Jan 6. 10.1021/acssensors.2c01921 PubMed 36608338