Skip to main content
Addgene
Open Menu

pCMV_NOPLight-ctr
(Plasmid #195579)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195579 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 195579-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 195579-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 3986
  • Total vector size (bp) 5909
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NOPLight-ctr
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1923
  • Mutation
    D110A, D130A
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ttccaaaatgtcgtaacaactccgcc
  • 3′ sequencing primer ttgctttatttgtaaccattataagctgc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV_NOPLight-ctr was a gift from Tommaso Patriarchi (Addgene plasmid # 195579 ; http://n2t.net/addgene:195579 ; RRID:Addgene_195579)

  • For your References section:

    Development of a genetically encoded sensor for probing endogenous nociceptin opioid peptide release. Zhou X, Stine C, Prada PO, Fusca D, Assoumou K, Dernic J, Bhat MA, Achanta AS, Johnson JC, Pasqualini AL, Jadhav S, Bauder CA, Steuernagel L, Ravotto L, Benke D, Weber B, Suko A, Palmiter RD, Stoeber M, Kloppenburg P, Bruning JC, Bruchas MR, Patriarchi T. Nat Commun. 2024 Jun 25;15(1):5353. doi: 10.1038/s41467-024-49712-0. 10.1038/s41467-024-49712-0 PubMed 38918403
Related items:
Commonly requested with: