pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-NORAD
(Plasmid
#196086)
-
PurposeInducible CRISPRi vector conferring puromycin resistance, expressing gRNA targeting lncRNA NORAD.
-
Depositing Lab
-
Depositing OrganizationJagiellonian University
Located in Poland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196086 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 196086-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 196086-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSBtet-Pur-dCas9-KRAB-MeCP2_hU6-SapI
-
Backbone manufacturerCzarnek et al., 2021
- Backbone size w/o insert (bp) 11264
- Total vector size (bp) 11266
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting lncRNA NORAD
-
SpeciesSynthetic
-
MutationCloned using SapI sites - destroyed after insertion
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 196086-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 196086-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-NORAD was a gift from Joanna Bereta (Addgene plasmid # 196086 ; http://n2t.net/addgene:196086 ; RRID:Addgene_196086) -
For your References section:
Construction of a Set of Novel Transposon Vectors for Efficient Silencing of Protein and lncRNA Genes via CRISPR Interference. Czarnek M, Kochan J, Wawro M, Myrczek R, Bereta J. Mol Biotechnol. 2023 Jan 28. doi: 10.1007/s12033-023-00675-5. 10.1007/s12033-023-00675-5 PubMed 36707469