pSLQ1658-dCas9-EGFP
(Plasmid #51023)

• Purpose: Template for NLS-dCas9-NLS-EGFP fusion protein for CRISPR imaging (the recipient vector can be TetON 3G promoter system)
• Depositing Labs: Bo Huang, Stanley Qi
• Publication: Chen et al Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001.

Backbone

• Vector backbone: pMSCVpuro
• Total vector size (bp): 11177
• Modifications to backbone: None
• Vector type: Mammalian Expression, Retroviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: We suggest using Stellar (Clontech) for growth
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9 fuse to EGFP
• Species: H. sapiens (human)
• Insert Size (bp): 4887
• Promoter: MSCV LTR promoter
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ctcgatcctccctttatccagcc
• 3′ sequencing primer: ggctgctaaagcgcatgct

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 14 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry