-
PurposeLentiviral vector that contains an optimized S. pyogenes sgRNA targeting human telomeres
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51024 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSico
- Total vector size (bp) 8320
-
Modifications to backboneNone
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsThe depositing laboratory suggests using Stellar (Clontech) for growth and maximum yield of the vector; however, the plasmid is provided in NEB Stable to reduce the chance of recombination.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOptimized sgRNA
-
Alt namesgRNA(F+E)
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)115
- Promoter mouse U6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer atccgacgcgccatctctag
- 3′ sequencing primer tgcatggcggtaatacggttatc (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA target sequence GTTAGGGTTAGGGTTAGGGTTA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ1651-sgTelomere(F+E) was a gift from Bo Huang & Stanley Qi (Addgene plasmid # 51024 ; http://n2t.net/addgene:51024 ; RRID:Addgene_51024) -
For your References section:
Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. Chen B, Gilbert LA, Cimini BA, Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. 10.1016/j.cell.2013.12.001 PubMed 24360272