Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSLQ1651-sgTelomere(F+E)
(Plasmid #51024)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51024 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSico
  • Total vector size (bp) 8320
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    The depositing laboratory suggests using Stellar (Clontech) for growth and maximum yield of the vector; however, the plasmid is provided in NEB Stable to reduce the chance of recombination.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Optimized sgRNA
  • Alt name
    sgRNA(F+E)
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    115
  • Promoter mouse U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstXI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer atccgacgcgccatctctag
  • 3′ sequencing primer tgcatggcggtaatacggttatc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA target sequence GTTAGGGTTAGGGTTAGGGTTA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ1651-sgTelomere(F+E) was a gift from Bo Huang & Stanley Qi (Addgene plasmid # 51024 ; http://n2t.net/addgene:51024 ; RRID:Addgene_51024)
  • For your References section:

    Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. Chen B, Gilbert LA, Cimini BA, Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. 10.1016/j.cell.2013.12.001 PubMed 24360272