Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #100547)


Item Catalog # Description Quantity Price (USD)
Plasmid 100547 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7064
  • Total vector size (bp) 11244
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Gene/Insert 1

  • Gene/Insert name
    N-terminal Flag and biotin-acceptor-site (FB)-tagged dCas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
  • Promoter Human EF1a
  • Tag / Fusion Protein
    • FLAG, Biotin-acceptor-site (Avitag) (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTTCCATTTCAGGTGTCGTG
  • 3′ sequencing primer ctggccacctctgcttgt
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Species
    Streptomyces alboniger
  • Insert Size (bp)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF1a-FB-dCas9-puro was a gift from Jian Xu (Addgene plasmid # 100547 ; ; RRID:Addgene_100547)
  • For your References section:

    In Situ Capture of Chromatin Interactions by Biotinylated dCas9. Liu X, Zhang Y, Chen Y, Li M, Zhou F, Li K, Cao H, Ni M, Liu Y, Gu Z, Dickerson KE, Xie S, Hon GC, Xuan Z, Zhang MQ, Shao Z, Xu J. Cell. 2017 Aug 24;170(5):1028-1043.e19. doi: 10.1016/j.cell.2017.08.003. 10.1016/j.cell.2017.08.003 PubMed 28841410