Skip to main content

pBridge-tyrosinase.σ2
(Plasmid #197415)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197415 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pBridge
  • Backbone size w/o insert (bp) 6526
  • Total vector size (bp) 7367
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    tyrosinase cytosolic tail
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    428
  • Mutation
    silent substitution in codon 2 of tyrosinase tail (encoding residue 500 of full length protein); insert contains 317 nucleotides of 3' UTR
  • Promoter ADH1
  • Tag / Fusion Protein
    • GAL4-DNA binding domain fragment (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer GAL4 DNA binding domain forward
  • 3′ sequencing primer GAL4 DNA binding domain reverse
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    AP-2 σ2
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    429
  • Mutation
    encodes R42G substitution, contains silent substitutions in codons 3, 4, 5, 138 and 140
  • Promoter MET25
  • Tags / Fusion Proteins
    • HA tag (N terminal on backbone)
    • nuclear localization signal (NLS) (N terminal on backbone)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer 5' gatacaattctattacccccatcc (MCS2F)
  • 3′ sequencing primer 5' gcaacacctggcaattccttacc (MCS2R)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

To test interaction of novel sorting signals with AP-2 subunits, excise tyrosinase tail insert from this construct with BamH1/PstI and subclone BamH1/PstI DNA fragment encoding novel signal in MCS1. Do not use other restriction sites in MCS1 as they may be also present in insert subcloned in MCS2.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBridge-tyrosinase.σ2 was a gift from Juan Bonifacino (Addgene plasmid # 197415 ; http://n2t.net/addgene:197415 ; RRID:Addgene_197415)
  • For your References section:

    Conservation and diversification of dileucine signal recognition by adaptor protein (AP) complex variants. Mattera R, Boehm M, Chaudhuri R, Prabhu Y, Bonifacino JS. J Biol Chem. 2011 Jan 21;286(3):2022-30. doi: 10.1074/jbc.M110.197178. Epub 2010 Nov 19. 10.1074/jbc.M110.197178 PubMed 21097499