pBK- Ma PylRS WT
(Plasmid #197573)

• Purpose: Expresses wild-type Methanomethylophilus alvus pyrrolysine tRNA synthetase under GlnS promoter. Used for Pyl tRNA-synthetase selections.
• Depositing Lab: Ryan Mehl
• Publication: Avila-Crump et al ACS Chem Biol. 2022 Dec 16;17(12):3458-3469. doi: 10.1021/acschembio.2c00639. Epub 2022 Nov 16.

Backbone

• Vector backbone: pBK
• Total vector size (bp): 2854
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: M. alvus PylRS WT
• Species: Methanomethylophilus alvus
• Promoter: GlnS (constitutive)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: tgctgagttgaaggatcctcgg

Resource Information

• Supplemental Documents:
  • pBK Ma Pyl RS WT.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid only expresses the M. alvus Pyl tRNA synthetase and is used specifically for synthetase selections. It does not co-express the cognate Ma Pyl-tRNA. Libraries of Pyl-RS mutants can be built on this plasmid, and then paired with the M. alvus positive selection plasmid (197571), negative selection plasmid (197572) or fluorescence reporter plasmid (197574). This plasmid cannot be paired with with traditional E. coli expression vectors (e.g. pET, pBAD) for incorporation of non-canonical amino acids since it lacks expression of the cognate Pyl-tRNA and origin of replication compatibility issues.