pRSF-G1TMSNKRS
(Plasmid #198323)

• Purpose: tRNA synthetase/tRNA pair for the in vivo incorporation of N6-(((trimethylsilyl)methyl)carbamoyl)-L-lysine (TMSNK), into proteins in E. coli in response to the amber (TAG) codon
• Depositing Lab: Thomas Huber
• Publication: Ekanayake et al J Med Chem. 2023 Mar 15. doi: 10.1021/acs.jmedchem.3c00222.

Backbone

• Vector backbone: pRSF
• Backbone size w/o insert (bp): 2452
• Total vector size (bp): 3274
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tRNA synthetase
• Alt name: G1TMSNKRS
• Species: Methanogenic archaeon ISO4-G1
• Insert Size (bp): 822
• Promoter: T7

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry