pTET2-RlucCP
(Plasmid
#198352)
-
PurposePart of Firefly reporter system, encodes Renilla luciferase
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198352 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 198352-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 198352-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneUnknown
-
Backbone manufacturerUnknown
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6318
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRenilla Luciferase
-
SpeciesRenilla
-
Insert Size (bp)1669
- Promoter pTET2
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer agcagagctcgtttagtgaacc
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCloned by Jason Nathanson, Yeo Lab co-author on paper
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 198352-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 198352-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTET2-RlucCP was a gift from Eugene Yeo (Addgene plasmid # 198352 ; http://n2t.net/addgene:198352 ; RRID:Addgene_198352) -
For your References section:
Large-scale tethered function assays identify factors that regulate mRNA stability and translation. Luo EC, Nathanson JL, Tan FE, Schwartz JL, Schmok JC, Shankar A, Markmiller S, Yee BA, Sathe S, Pratt GA, Scaletta DB, Ha Y, Hill DE, Aigner S, Yeo GW. Nat Struct Mol Biol. 2020 Oct;27(10):989-1000. doi: 10.1038/s41594-020-0477-6. Epub 2020 Aug 17. 10.1038/s41594-020-0477-6 PubMed 32807991