pTET2-RlucCP-3MS2
(Plasmid
#198354)
-
PurposePart of Renilla reporter system, encodes Renilla luciferase with MS2 stem loops in the 3'UTR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198354 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneUnknown
-
Backbone manufacturerUnknown
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6677
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRenilla Luciferase
-
SpeciesRenilla
-
Insert Size (bp)1980
- Promoter pTET2
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer agcagagctcgtttagtgaacc
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCloned by Jason Nathanson, Yeo Lab co-author on paper
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTET2-RlucCP-3MS2 was a gift from Eugene Yeo (Addgene plasmid # 198354 ; http://n2t.net/addgene:198354 ; RRID:Addgene_198354) -
For your References section:
Large-scale tethered function assays identify factors that regulate mRNA stability and translation. Luo EC, Nathanson JL, Tan FE, Schwartz JL, Schmok JC, Shankar A, Markmiller S, Yee BA, Sathe S, Pratt GA, Scaletta DB, Ha Y, Hill DE, Aigner S, Yeo GW. Nat Struct Mol Biol. 2020 Oct;27(10):989-1000. doi: 10.1038/s41594-020-0477-6. Epub 2020 Aug 17. 10.1038/s41594-020-0477-6 PubMed 32807991