N-terminal 3X Flag Human CASP9 C287A Mutant
(Plasmid #198380)

• Purpose: Expresses Human N-Terminal 3X Flag CASP9 Catalytic Mutant in Mammalian Cells
• Depositing Lab: Hannah Rabinowich
• Publication: Han et al Autophagy. 2021 Jun;17(6):1393-1409. doi: 10.1080/15548627.2020.1761742. Epub 2020 May 25.

Backbone

• Vector backbone: pCR3.1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4994
• Total vector size (bp): 6349
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: N-Terminal 3X Flag Human Caspase-9 C287A Mutant
• Alt name: CASP-9; ICE-LAP6; Mch6; APAF-3
• Species: H. sapiens (human)
• Insert Size (bp): 1355
• Mutation: Changed Cysteine 287 to Alanine to eliminate protease activity
• GenBank ID: NM_001229
• Entrez Gene: CASP9 (a.k.a. APAF-3, APAF3, ICE-LAP6, MCH6, PPP1R56)
• Promoter: CMV
• Tag / Fusion Protein:
  • 3X Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (destroyed during cloning)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry