Human DsRed-Monomer CASP9 C287A Mutant
(Plasmid #198469)

• Purpose: Expresses Human DsRed-Monomer CASP9 C287A Mutant Fusion Protein in Mammalian Cells
• Depositing Lab: Hannah Rabinowich
• Publication: Human DsRed-Monomer CASP9 C287A Mutant (unpublished)

Backbone

• Vector backbone: pDsRed-Monomer-Hyg-C1
• Backbone manufacturer: Takara Bio USA
• Backbone size w/o insert (bp): 5685
• Total vector size (bp): 6968
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Human Caspase-9 C287A Mutant
• Alt name: CASP-9; ICE-LAP6; Mch6; APAF-3
• Species: H. sapiens (human)
• Insert Size (bp): 1283
• Mutation: Changed Cysteine 287 to Alanine to eliminate protease activity
• GenBank ID: NM_001229
• Entrez Gene: CASP9 (a.k.a. APAF-3, APAF3, ICE-LAP6, MCH6, PPP1R56)
• Promoter: CMV
• Tag / Fusion Protein:
  • DsRed-monomer (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sal I (not destroyed)
• 3′ cloning site: BamH I (not destroyed)
• 5′ sequencing primer: TACAAGGCCAAGAAGCCCGTG
• 3′ sequencing primer: GCTGATTATGATCAGTTATCT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry