PAM1
(Plasmid
#198740)
-
PurposepTFIID-GFP, Geneticin resistance
-
Depositing Lab
-
Depositing OrganizationCNRS UMR 7256, Laboratoire Information Genomique et Structurale
Located in France -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198740 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 198740-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 198740-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePAM1
- Backbone size w/o insert (bp) 5427
- Total vector size (bp) 5427
-
Vector typeAcanthamoeba expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP
-
Insert Size (bp)720
- Promoter pTFIID
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NdeI (not destroyed)
- 5′ sequencing primer AGATCTTCAATATTGGCCATTAGCC
- 3′ sequencing primer CATATGCTTGTTGTATGTGTGAATC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 198740-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 198740-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PAM1 was a gift from Chantal Abergel (Addgene plasmid # 198740 ; http://n2t.net/addgene:198740 ; RRID:Addgene_198740) -
For your References section:
Genetic manipulation of giant viruses and their host, Acanthamoeba castellanii. Philippe N, Shukla A, Abergel C, Bisio H. Nat Protoc. 2023 Nov 14. doi: 10.1038/s41596-023-00910-y. 10.1038/s41596-023-00910-y PubMed 37964008