Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PAM3
(Plasmid #198742)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 198742 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PAM3
  • Backbone size w/o insert (bp) 5667
  • Total vector size (bp) 5667
  • Vector type
    Acanthamoeba expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFP
  • Insert Size (bp)
    720
  • Promoter pTPBF

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NdeI (not destroyed)
  • 5′ sequencing primer AGATCTCTTGGATCGGGCGCTGAAC
  • 3′ sequencing primer CATATGATTTCTAGAGGCACAAGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PAM3 was a gift from Chantal Abergel (Addgene plasmid # 198742 ; http://n2t.net/addgene:198742 ; RRID:Addgene_198742)
  • For your References section:

    Genetic manipulation of giant viruses and their host, Acanthamoeba castellanii. Philippe N, Shukla A, Abergel C, Bisio H. Nat Protoc. 2023 Nov 14. doi: 10.1038/s41596-023-00910-y. 10.1038/s41596-023-00910-y PubMed 37964008
Commonly requested with: