Skip to main content

PAM10
(Plasmid #198743)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198743 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 198743-D50 50 μg of DNA in Tris buffer $495
DNA 198743-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    PAM10
  • Backbone size w/o insert (bp) 5695
  • Total vector size (bp) 5695
  • Vector type
    Acanthamoeba expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFP
  • Insert Size (bp)
    720
  • Promoter pEF1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NdeI (not destroyed)
  • 5′ sequencing primer AGATCTGCGAGGGGAGATGGTTGAAG
  • 3′ sequencing primer CATATGGGTGGATTGGTGGTGTTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PAM10 was a gift from Chantal Abergel (Addgene plasmid # 198743 ; http://n2t.net/addgene:198743 ; RRID:Addgene_198743)
  • For your References section:

    Genetic manipulation of giant viruses and their host, Acanthamoeba castellanii. Philippe N, Shukla A, Abergel C, Bisio H. Nat Protoc. 2023 Nov 14. doi: 10.1038/s41596-023-00910-y. 10.1038/s41596-023-00910-y PubMed 37964008
Commonly requested with: