Skip to main content

pEGFP-C2-GGA2
(Plasmid #199172)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199172 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 199172-D50 50 μg of DNA in Tris buffer $495
DNA 199172-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-C2
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 6604
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GGA2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1863
  • Mutation
    Ala 23 Thr substitution; silent substitution in codon 66
  • Entrez Gene
    GGA2 (a.k.a. VEAR)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pEGFP-C forward: 5’ CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer pEGFP-C reverse: 5’ GCTTTATTTGTGAAATTTGTGATGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

GGA2 insert was excised with EcoRI using limiting amounts of restriction enzyme (partial digestion). The internal EcoRI site in human GGA2 cDNA is intact. Construct contains an additional 21 bp after stop codon before EcoRI site at 3'.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C2-GGA2 was a gift from Juan Bonifacino (Addgene plasmid # 199172 ; http://n2t.net/addgene:199172 ; RRID:Addgene_199172)
  • For your References section:

    Divalent interaction of the GGAs with the Rabaptin-5-Rabex-5 complex. Mattera R, Arighi CN, Lodge R, Zerial M, Bonifacino JS. EMBO J. 2003 Jan 2;22(1):78-88. doi: 10.1093/emboj/cdg015. 10.1093/emboj/cdg015 PubMed 12505986