Skip to main content
Addgene
Open Menu

pCMV-RKIP_RFP
(Plasmid #199215)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199215 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 199215-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 199215-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    LPUtopia-7
  • Backbone manufacturer
    Balazsi Lab
  • Backbone size w/o insert (bp) 4139
  • Total vector size (bp) 9832
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    RKIP
  • Alt name
    RKIP
  • Alt name
    phosphatidylethanolamine binding protein 1
  • Alt name
    RAF-kinase inhibitor protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    561
  • GenBank ID
    NM_002567.4
  • Entrez Gene
    PEBP1 (a.k.a. HCNP, HCNPpp, HEL-210, HEL-S-34, HEL-S-96, PBP, PEBP, PEBP-1, RKIP)
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gacattgattattgactagt
  • 3′ sequencing primer TCTGGGAAGTAAgcgactct
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    RFP
  • Alt name
    RFP
  • Species
    Synthetic
  • Promoter PGK

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAGAAGCCCGTGgggtag
  • 3′ sequencing primer cagggtaattcgaatttaaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-RKIP_RFP was a gift from Gabor Balazsi (Addgene plasmid # 199215 ; http://n2t.net/addgene:199215 ; RRID:Addgene_199215)

  • For your References section:

    Nonmonotone invasion landscape by noise-aware control of metastasis activator levels. Wan Y, Cohen J, Szenk M, Farquhar KS, Coraci D, Krzyszton R, Azukas J, Van Nest N, Smashnov A, Chern YJ, De Martino D, Nguyen LC, Bien H, Bravo-Cordero JJ, Chan CH, Rosner MR, Balazsi G. Nat Chem Biol. 2023 Jul;19(7):887-899. doi: 10.1038/s41589-023-01344-z. Epub 2023 May 25. 10.1038/s41589-023-01344-z PubMed 37231268
Related items:
Commonly requested with: