-
Purpose(Empty Backbone) Express gene of interest under CMV promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72265 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCDH-CMV-MCS
-
Backbone manufacturerSystembio
- Backbone size (bp) 6227
-
Modifications to backboneClaI/Sal fragment was replace with CMV promoter + new MCS
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer GGCACCAAAATCAACGGGAC
- 3′ sequencing primer CAACACCACGGAATTGTCAG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The depositor noted that the single nucleotide mismatch (C>T, bp2193) within the CMV promoter found in Addgene's quality control sequence does NOT affect plasmid function
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-CMV was a gift from Kazuhiro Oka (Addgene plasmid # 72265 ; http://n2t.net/addgene:72265 ; RRID:Addgene_72265)